Germline mutation analysis of Tpit in Poodle dogs with ACTH-dependent hyperadrenocorticism / Análise de mutação germinativa do Tpit em cães da raça Poodle com hiperadrenocorticismo ACTH-dependente

There is a high incidence of pituitary-dependent hyperadrenocorticism (PDH) in Poodle dogs, with family members being affected by the disease, suggesting a genetic involvement. Tpit is an obligate transcription factor for the expression of pro-opiomelanocortingene and for corticotroph terminal differentiation. The aim of the present study was to screen the Tpit gene for germline mutations in Poodles with PDH. Fifty Poodle dogs (33 female, 8.71±2.8 years) with PDH and 50 healthy Poodle dogs (32 females, 9.4241 2.8 years) were studied. Genomic DNA was isolated from peripheral blood, amplified by PCR and submitted to automatic sequence. No mutation in the coding region of Tpit was found, whereas the new single nucleotide polymorphism p.S343G, in heterozygous state, was found in the same frequency in both PDH and control groups. We concluded that Tpit gain-of-function mutations are not involved in the etiology of PDH in Poodle dogs.

O hiperadrenocorticismo ACTH-dependente (HACAD) apresenta elevada incidência em cães da raça Poodle, sendo que membros da mesma família têm sido acometidos pela doença, sugerindo envolvimento genético. Tpit é um fator de transcrição obrigatório para a expressão do gene da pro-opiomelanocortina e para a diferenciação terminal dos corticotrofos. O objetivo deste trabalho foi pesquisar mutações germinativas no gene Tpit em Poodles com HACAD. Cinquenta cães da raça Poodle, 33 fêmeas, média de idade de 8,71±2,8 anos, com HACAD, e 50 cães Poodles saudáveis, 32 fêmeas, média de idade de 9,4±2,8 anos, foram estudados. Mutações na região codificadora do gene Tpit não foram identificadas. Foi observado um novo polimorfismo em heterozigose, p.S343G, com a mesma frequência no grupo de cães com HACAD e no grupo-controle. Conclui-se que a mutação ativadora no gene Tpit não está envolvida na patogênese do hiperadrenocorticismo ACTH-dependente em cães da raça Poodle.

Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

OBJECTIVE: PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. DESIGN: Pituitary function and imaging assessment and molecular analysis of PROP1. PATIENTS: Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. METHODS: Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. RESULTS: MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. CONCLUSIONS: We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

Analysis of DNA in minute volumes of blood from stains and crusts.

As the first step, the locus D1S80 was amplified by the polymerase chain reaction technique from genomic DNA extracted from artificial bloodstains and crusts with different amount of blood (32 microl, 16 microl, 8 microl, 4 microl, 2 microl, and 1 microl). In all samples of bloodstains and crusts, identification by DNA analysis was possible. As the second step, the locus HLA-DQA1 was amplified from genomic DNA extracted from diluted blood samples (640, 320, 160, 80, 40, 20, 10, and 5 leukocytes). DNA amplification was possible in diluted blood samples with at least 10 leukocytes. Considering the conditions in which the present study was carried out, it was possible to conclude that 1 microl of bloodstains or crusts was enough for identification. It was also concluded that five leukocytes are not enough material to render consistent DNA identification.

Molecular analysis of SRY gene in Brazilian 46,XX sex reversed patients: absence of SRY sequence in gonadal tissue.

BACKGROUND: The importance of the Y chromosome in male determination has been well established for a long time. The presence of a translocation of chromosomal material encoding the Testis-Determining Factor from Y to another chromosome has been one of the hypothesis to explain testicular development in XX sex-reversed patients. MATERIAL AND METHODS: In the present study, we searched for SRY sequence in genomic DNA isolated from peripheral leukocytes in eleven 46,XX true hermaphrodites and four 46,XX males (only one with ambiguous genitalia). We also analyzed the presence of SRY sequence in fresh gonadal tissues from two 46,XX true hermaphrodites. RESULTS: SRY sequence was absent in DNA blood samples of all true hermaphrodites and in testicular and ovarian tissues of two cases studied. Of the four 46,XX males, two with normal male external genitalia were SRY positive. CONCLUSIONS: We did not identify the SRY gene in 46,XX true hermaphrodites and 46,XX males with ambiguous genitalia, therefore SRY translocation to X chromosome or autosome is unlikely. Hidden Y mosaicism in gonadal tissues was also ruled out in two cases, suggesting that cryptic SRY mosaicism in gonadal tissues is not the usual mechanism responsible for testicular development in patients with 46,XX true hermaphroditism. However, SRY gene was identified in two 46,XX males with male external genitalia showing that SRY gene determined their male phenotype. Despite the recent advances in the knowledge of the role of several genes involved in sexual determination we are still unable to explain the cause of most of Y-chromosome-negative 46,XX sex-reversed patients.

21-Hydroxylase deficiency in Brazil.

We determined the frequency of large rearrangements and point mutations in 130 Brazilian patients with 21-hydroxylase deficiency and correlated genotype with phenotype. The frequency of CYP21 deletions was lower (4.4%) than in most of the previous series described, whereas the frequency of large gene conversions was similar to the frequency reported in the literature (6.6%). The most frequent point mutations were I2 splice (41.8% in salt wasting - SW), I172N (32.6% in simple virilizing - SV) and V281L (40.2% in the late onset form - LO). The frequency of the nine most common point mutations was similar to that reported for other countries. The 93 fully genotyped patients were classified into 3 mutation groups based on the degree of enzymatic activity (A<2%, B approximately 2%, C>20%). In group A, 62% of cases presented the SW form; in group B, 96% the SV form, and in group C, 88% the LO form. We diagnosed 80% of the affected alleles after screening for large rearrangements and 15 point mutations. To diagnose these remaining alleles we sequenced the CYP21 gene of one patient with the SV form and identified a heterozygous G-->A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region and was also found in a compound heterozygous state in 4 other patients. The mutation G424S presented a linkage disequilibrium with CYP21P and C4A gene deletions and HLA DR17, suggesting a probable founder effect. Search for the G424S mutation in other populations will reveal if it is restricted to the Brazilian patients or if it has a wider ethnic distribution.

Parentage testing on blood crusts from firearms projectiles by DNA typing settles and insurance fraud case.

We describe a case of a fraudulent insurance claim. The family of an adult white male (DLF) notified the police of their son's disappearance. After a few weeks, a corpse that presented characteristics similar to those of the DLF was found in advanced stages of decay and was identified by the family as being DLF. The family then filed a claim for the life insurance that DLF had taken out just before he disappeared. Suspicions were raised about the identification of the corpse, because it had been done only visually, and because the insurance policy had been taken out just prior to DLF's disappearance. The insurance company requested a postmortem examination for identification. As the corpse had been cremated immediately after identification by the family, the biological material that was encrusted on the two projectiles removed from the body was used for analysis. The blood crusts provided enough genomic DNA for us to carry out PCR base typing of HLA-DQA1, D1S80, HUMCSF1PO, HUMTPOX, HUMTH01, D3S1744, D12S1090, D18S849, and amelogenin. Results from all loci typing from the corpse presumed to be that of DLF were then compared with that of his alleged biological parents, revealing genetic incompatibility.

Allele and genotype frequencies for D1S80 locus in a Brazilian population sample.

Gene and genotype frequencies in relation to the D1S80 locus were determined in a sample of 197 unrelated individuals (144 Caucasians and 53 Mulattoes), living in the city of São Paulo, Brazil. The Mulatto group was composed by mixed individuals who presented at least one negroid physical characteristic or declared themselves to be of mixed (Black-White) ancestry. Nineteen different alleles were detected in the Caucasian sample and 15 among Mulattoes. Alleles 18 and 24 were found to be the most common ones in the Caucasian population with frequencies of 0.173 and 0.357 respectively; the sample heterozygote frequency was estimated in 0.824. Alleles 18, 24, and 28 were found to be the most common alleles among Mulattoes with respective frequencies of 0.150, 0.349, and 0.113; the sample heterozygote frequency was 0.759. Fifty-five different genotypes were detected among Brazilian Caucasians whereas the respective figure among Mulattoes was 31. No significant deviations from Hardy-Weinberg equilibrium were found in both population samples.

Post-mortem forensic identity testing: application of PCR to the identification of fire victim.

CONTEXT: DNA analysis has been used with success in the identification of carbonized corpses and victims of large accidents. The analysis requires relatives of crash victims to donate blood for analysis. The relatives are generally willing contribute to the identification by giving a blood sample. OBJECTIVE: To describe the use of the polymerase chain reaction (PCR) for genetic characterization of one victim extensively burned by fire. DESIGN: Case report. CASE REPORT: DNA was extracted from blood of the cardiac chamber, and 15 different loci (D1S80, ApoB, D17S30, D3S1744, D18S849, D12S1090, FGA, D7S820, D1S533, D9S304, HUMCSF1PO, HUMTPOX, HUMTHO1, amelogenin and HLA-DQA1) were analyzed using the PCR technique. Results from all loci typing of the corpse were then compared to that of his alleged biological parents, revealing a genetic compatibility.

Influence of different genotypes on 17-hydroxyprogesterone levels in patients with nonclassical congenital adrenal hyperplasia due to 21-hydroxylase deficiency.

OBJECTIVE: The diagnosis of the nonclassical form of 21-hydroxylase (NC-21OH) deficiency, established before molecular studies, is based on basal 17OH-progesterone (17OH-P) values > 15 nmol/l or ACTH-stimulated 17OH-P values > 30 nmol/l. This disease is caused by mutations in the structural gene that can be grouped into three categories: A, B and C, according to the predicted level of enzymatic activity. So, the genotype of the nonclassical form is a combination of mutations that cause moderate impairment of enzymatic activity in one allele and mutations which cause total (A), severe (B: 3%) or moderate (C: 20-60%) impairment of enzymatic activity in the other allele. DESIGN: We analysed the influence of the different genotypes on 17OH-P levels in 58 patients with the nonclassical form of 21OH deficiency. RESULTS: After screening for 18 mutations through Southern blotting, allele-specific polymerase chain reaction (PCR) and enzyme restriction, mutations were identified in 73% of the alleles. Patients with mutations identified in both alleles were divided into groups A/C (n = 18), B/C (n = 3) and C/C (n = 15). The basal and ACTH-stimulated 17OH-P levels in patients with A/C genotype ranged from 1.2 to 153 and 72-363 nmol/l, and in C/C genotype ranged from 0.9 to 72 and 51-363 nmol/l, respectively (P < 0.05 for stimulated levels). The lowest value of ACTH-stimulated 17OH-P levels in fully genotyped patients was 51 nmol/l. Patients with the A/C genotype presented androgen excess symptoms earlier than patients with the C/C genotype. CONCLUSIONS: These data suggest an influence of genotype on phenotype and on 17OH-P levels. The high frequency of unidentified mutant alleles in nonclassical 21-hydroxylase deficiency suggests that ACTH-stimulated values of 17OH-P between 30 and 51 nmol/l have overestimated this diagnosis. Genotyping more patients with nonclassical 21-hydroxylase deficiency will help to redefine the cut-off value for ACTH-stimulated 17OH-P for correct diagnosis of this disease.

Gene and genotype frequencies for HLA-DQA1 in Caucasians and Mulattoes in Brazil.

Gene and genotype frequencies of the HLA-DQA1 locus were determined in a sample of 197 unrelated individuals (144 Caucasians and 53 Mulattoes), living in the city of São Paulo, Brazil. The Mulatto group consisted of mixed individuals who presented at least one negroid physical characteristic or declared themselves to be of mixed ancestry. A total of six different alleles were identified with frequencies ranging from 0.087 to 0.316 in the Caucasian population and from 0.066 to 0.330 in the Mulatto population. We observed an increased frequency of allele 1.2 among Mulattoes in relation to Caucasians. The sample heterozygote frequency was 0.722 among Caucasians and 0.736 among Mullatoes. No significant deviations from Hardy-Weinberg equilibrium were found either in the Caucasian or in the Brazilian Mullato population samples.

A novel point mutation (R840S) in the androgen receptor in a Brazilian family with partial androgen insensitivity syndrome.

Mutations of the androgen receptor gene causing androgen insensitivity syndrome in 46, XY individuals, result in phenotypes ranging from complete female to ambiguous genitalia to males with minor degrees of undervirilization. We studied two Brazilian brothers with partial androgen insensitivity syndrome. They were born with perineal hypospadias, bifid scrotum, small penis and cryptorchidism, and developed gynecomastia at puberty. Genomic DNA was extracted and denaturinggradient gel electrophoresis of exon 7 of the androgen receptor gene followed by sequence analysis revealed a new mutation, a C A transversion, altering codon 840 from arginine (CGT) to serine (AGT). R840 is located in the androgen binding domain, in a "hot spot" region, important for the formation and function of the hormone receptor-complex and within the region that is involved in androgen receptor dimerization. Replacement of arginine (basic) by serine (neutral and polar) is a nonconservative substitution. Three mutations in this residue (R840C, R840G nonconservative and R840H, conservative) were previously reported in patients with partial androgen insensitivity syndrome and when expressed "in vitro" lead to a subnormal transactivation of a reporter gene. We conclude that the novel R840 mutation in the androgen receptor is the cause of partial androgen insensitivity syndrome in this Brazilian family.

A novel missense mutation, GLY424SER, in Brazilian patients with 21-hydroxylase deficiency.

A previous screening of 17 mutations in 130 Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency did not identify mutations in 20% of the alleles. To diagnose these alleles we sequenced the entire CYP21 gene of one Mulatto patient with the simple virilizing form, who had only the R356W mutation in a heterozygous state. We identified a heterozygous G-A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region where glycine is conserved in at least 4 species. This novel mutation eliminates 1 of the restriction sites of the BanI enzyme, which made its screening possible for the whole series. The G424S mutation was found in a compound heterozygous state in 5 families; 4 presented the simple virilizing form, and 1 presented the nonclassical form. Interestingly, 3 of 5 families have a Mulatto origin. This mutation was not identified in 118 CYP21 alleles of normal individuals, ruling out the possibility of a polymorphism, or in 80 pseudogenes, indicating a casual mutagenic event and not a microconversion event. All patients with the G424S mutation presented CYP21P and C4A gene deletions and human leukocyte antigen DR17 on the same haplotype, suggesting a linkage disequilibrium and a probable founder effect. Search for the G424S mutation in other populations will reveal whether it is restricted to the Brazilian patients or if it has a wider ethnic distribution.

Low frequency of CYP2B deletions in Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylas deficiency.

The frequency of large mutations was determined in 131 Brazilian patients with different clinical forms of 21-hydroxylase deficiency, belonging to 116 families. DNA samples were examined by Southern blotting hybridization with genomic CYP21 and C4cDNA probes after Taql and Bg/II restriction. Large gene conversions were found in 6.6% and CYP21B deletions in 4.4% of the alleles. The breakpoint in these hybrid genes occurred after exon 3 in 92% of the alleles. All rearrangements involving CYP21B gene occurred in the heterozygous form, except in a patient with simple virilizing form who presented homozygous CYP21B deletion. Our data showed that in these Brazilian patients, CYP21B deletions were less frequent than in most of the large series previously reported.

Molecular genotyping in Brazilian patients with the classical and nonclassical forms of 21-hydroxylase deficiency.

The aim of our study was to determine, by allele-specific PCR, the frequency of point mutations in 130 Brazilian patients with the classical and nonclassical forms of 21-hydroxylase deficiency and to correlate genotype with phenotype. The most frequent mutations were 12 splice (41.8% in salt wasting), I172N (32.6% in simple virilizing), and V281L (40.2% in late onset form). The frequency of the 9 most common point mutations was similar to that reported for other countries, except for Del 8 nt and Cluster, which were less frequent in the classical form. Rarer mutations such as P453S, G291S, I7 splice, W405X, R483P, and R483-->frameshift were rarely found or were absent. The 93 fully genotyped patients were classified into 3 mutation groups, based on the degree of enzymatic activity (group A, <2%; group B, approximately 2%, and group C, >18%). In group A, 62% of the cases presented the salt wasting form; in group B, 96% the simple virilizing form; and in group C, 88% the late onset form. We diagnosed 80% of the affected alleles after screening for large rearrangements and 15 point mutations. The absence of previously described mutations in 20% of the affected alleles suggests the presence of new mutations in our population.

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.

A unique constitutively activating mutation in third transmembrane helix of luteinizing hormone receptor causes sporadic male gonadotropin-independent precocious puberty.

Several constitutively activating mutations have been demonstrated in the sixth transmembrane helix of the human LH receptor (hLHR) in boys with gonadotropin-independent precocious puberty. In the current study, we examined two unrelated Brazilian boys with gonadotropin-independent precocious puberty caused by two different heterozygous activating mutations of the hLHR. Direct sequencing of the entire exon 11 of the hLHR revealed a heterozygous substitution of T for G at nucleotide 1370, that converts Leu 457 to Arg in the third transmembrane helix of the hLHR in one affected boy. His biological parents had a normal hLHR gene sequence, establishing the sporadic nature of this novel Leu457Arg mutation. Human embryonic 293 cells expressing hLHR mutant (L457R) or hLHR wild-type bound CG with high affinity. However, cells expressing hLHR(L457R) exhibited significantly higher basal levels of cAMP (7- to 14-fold) than cells expressing the wild-type receptor, indicating constitutive activation of hLHR(L457R). Basal levels of cAMP in hLHR(L457R)-expressing cells were, nonetheless, not as great as the levels of cAMP produced by hLHR wild-type-expressing cells incubated with a saturating concentration of CG. Furthermore, cells expressing hLHR(L457R) were unresponsive to further stimulation by CG. This finding was confirmed in the patient by lack of an increase in serum testosterone after CG stimulation. These results suggest that the conformation of hLHR(L457R) mutant represents a different activated receptor state (R*) than the agonist-occupied wild-type receptor. We also identified the previously described Ala568Val mutation in the third intracellular loop of the LHR in the other affected African-Brazilian boy and his normal prepubertal sister, suggesting the inherited form of precocious puberty in this boy. We conclude that the third transmembrane helix is a potential area for activating mutations of the hLHR that cause male precocious puberty.

Detection of Leptospira DNA in patients with aseptic meningitis by PCR.

Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively.

A novel missense mutation (S18N) in the 5' non-HMG box region of the SRY gene in a patient with partial gonadal dysgenesis and his normal male relatives.

Mutations in the sex-determining region of the Y chromosome (the SRY gene) have been reported in low frequency in patients with 46,XY gonadal dysgenesis. We investigated 21 Brazilian 46,XY sex-reversed patients, who presented either complete or partial gonadal dysgenesis or embryonic testicular regression syndrome. Using Southern blotting, polymerase chain reaction, denaturing gradient gel electrophoresis and direct sequencing, we analyzed deletions and point mutations in the SRY gene. We found a missense mutation at codon 18 upstream of the 5' border of the HMG box of the SRY gene in one patient with partial gonadal dysgenesis. This variant sequence was also found in DNA obtained from blood and sperm cells of his father and in blood cells of his normal brother. The S18N mutation was not found in 50 normal males, ruling out the possibility of a common polymorphism. We identified a novel familial missense mutation (S18N) in the 5' non-HMG box of the SRY gene in 1 of 21 patients with 46,XY sex reversal.